Beginners - C++ Forum - December 2017 (Page 22)

Quick fix help, duplicate words and a few things

Hello, Could you please help me in fixing the following issues. Out putting only unique words after there sorted(No Duplicates). Showing the correc...

[7 replies] Last: For the longest name, go through the array TWICE. The first time shoul... (by lastchance)

by closed account NCRLwA7f

advice on reading in data for a project

Write your question here. Hello, I am working on a little project that I hope to make an app for personal use. I want to code a dichotomous key for local trees...

[1 reply] : I'd use a table. The more items you match on a given line the more li... (by SamuelAdams)

by Brandon33310

Help with text game please.

Hello, I am trying to code an adventure game for one of my classes, so far I have this. I have a question though. Once i go the main menu how would allow my pro...

[5 replies] Last: Okay here is what I have now, I still am at a delima though for making... (by Brandon33310)

by Minessota

Dynamic Allocation

Why does my program print 1.000000 for each array element? #include <cstdio> const int MaxSize = 25000; //display the program intro/overview void wel...

[2 replies] Last: because you wrote the value in the function into the variable "fill" a... (by jonnin)

by Ryoka117

tracing the output

I fully understand the output for the first function calling but I don't understand the output for the second function call. it displays in function: x=4 y=3 z...

[3 replies] Last: thanks, I was looking at it all wrong (by Ryoka117)

by arsalazhar336

Timer along with a c++ program.

I intend to make a simple minesweeper i am done with the most part but i am stuck at one place. I want to add a timer in it. The user will have 5 or 10 minutes ...

[1 reply] : You can use this system: #include <ctime> //for time() int main() {... (by goldenchicken)

by samatya

Queue - Store simulation , customer waiting time issue

I am trying to build a queue of customers in a store. all the variables are printing the appropriate values but the waitingTime one. I have been working on this...

[3 replies] Last: ok. what do you think it should print? is the value of waitingTime s... (by jonnin)

by adam2016

ASCII or Unicode

Sorry about the basic questions lately I've been taken quite a few steps back to make me a better programmer,so I was wondering what is going on here I looked u...

[2 replies] Last: wow your right time for me to take a break if I'm making mistakes like... (by adam2016)

by Yertoo

C++ random video selector.

I'm trying to write a program that will select and open a .mkv file in vlc media player. I have been using the rand() function, along with getline() to select a...

[6 replies] Last: No I had to remove the (" and ") from the beginning and end of each fi... (by Yertoo)

by adam2016

garbage values being printed out (1,2)

so I made a quick algorithm to check for duplicates and if it's detected don't add them to a new string,basically finding every letter in a string the algori...

[20 replies] Last: thanks jlb much appreciated =) (by adam2016)

by Ayoub Hashemi

Problem with simple calculation

I am a student in college and i have this first assignment to calculate netpay. the calculation of the gross pay, prsi, paye, and usc come out as correct but wh...

[1 reply] : Hello Ayoub Hashemi, Welcome to the forum. Sorry for the delay, but ... (by Handy Andy)

by trazafin

I NEED BIG HELP FOR employee Absent project:

I have a running code here. should really do the trick. I am having trouble releasing the information being input by user to the "outputFile" I need it to be ...

[2 replies] Last: Hello trazafin, The parts that needed fixed: The proto types: nt da... (by Handy Andy)

by darje

Recursion pseudo code

Write your question here. int A(int n) { if (n == 0) { // Base case: if n==0, return 0 return 0; } return max(...

[2 replies] Last: How can i see the algorithem in the debugger debuger in visual studio?... (by jonnin)

by KomRex

Game Of life Error _DEBUG_ERROR("vector subscript out of range");

Problem was fixed

[6 replies] Last: Please don't do that, @KomRex. As @goldenchicken says, it removes the ... (by lastchance)

by anuproy

How do I keyboard input in OpenGL

Hello, I am trying to solve my OpenGL pyramid project. If anyone can please help me with a code as soon as possible. I have to do when I build the code i...

[1 reply] : Things you might try.. (3 is probably what you want) 1) gui, where p... (by jonnin)

by adam2016

scope

hi guys this a similar question to my array question but differs slightly so I said I'll open another thread anyway this example is perfectly legal #...

[1 reply] : Hello adam2016, I am not saying I am the best at this, but I will giv... (by Handy Andy)

by ritzbitz

Trying to perform a swap to sort a vector

Hello, I'm having issues with a swap function to sort a vector from highest value to lowest or vice versa. Below is the code and with the current swap func...

[1 reply] : Hello ritzbitz, Welcome to the forum. and thank you for using code ta... (by Handy Andy)

by Jakubaz

string problem

HI. I have string: TATAGAGCTAGCTAGCTAGCTAGCTAGC Is there easy way to look for line like GATA in string and return index where that line start ? using this...

[3 replies] Last: You did ask for easy way. That is string::find() Note that there ar... (by keskiverto)

by zeroblank

on filling a string array it stores from 1 index not 0 why

Write your question here. #include <iostream> #include<string> #include<vector> using namespace std; int main() { int n; while(true){ cin>>n; ...

[6 replies] Last: it's specified that each line has a length of 25 If that is true, th... (by keskiverto)

by smitty007

Vectors

I have tried to run this program and every time that I do, it crashes. Do I have something wrong in my coding? Thank you for the help. #include <iostre...

[6 replies] Last: Thanks @Chervil, @Thomas1965. Yes, fair comment: I shouldn't have let... (by lastchance)

C++

Forum

Beginners - December 2017 (Page 22)