please wait
|
by masterinex
about operator overloading
|
| when i run this i get the following error: cannot overload functions distinguished by return type alone. Book& operator + (const Book& b1, const Book& ... |
|
Nov 30, 2017 at 11:48pm
[1 reply] : Not exactly sure what the compiler is trying to say there, but your fi... (by Ganado)
|
|
by Rale
output digits of an n number
|
| Hello guys, I have an problem with outputting all digits of an number. I know with 2, 3, 4, 5, 6 and so but i need to write all this code for lets say 3 digits... |
|
Nov 30, 2017 at 9:08pm
[4 replies] Last: #include <iostream> void digits( unsigned long long n ) { if (n) std:... (by lastchance)
|
|
by talemache
Problems with private variables
|
| Hey guys, I've been having a problem understanding why I can't write this code the way it is. So I have these class functions with the variables x and y bein... |
|
Nov 30, 2017 at 8:49pm
[6 replies] Last: This works so I guess all's well? ~Talemache bool compare(const Lo... (by talemache)
|
|
by Yana111
Unseen function
|
| I have a function findSum in my code, but my compilator neither sees it, nor outputs it. #include <iostream> #include <cstdlib> #include "math.h" using n... |
|
Nov 30, 2017 at 8:34pm
[3 replies] Last: Hello Yana111, What keskiverto said. Other than some warnings about c... (by Handy Andy)
|
|
by dubley
sizeof and placement new
|
| Hello, in the following code I am confused about what is going on in line 41: pd2 = new (buffer + N * sizeof(double)) double ; I cannot understand what sizeof i... |
|
Nov 30, 2017 at 8:17pm
[4 replies] Last: Thank you very much for your help. (by dubley)
|
|
by Jakubaz
read string
|
| HI. I have text file like this: TATAGTTGATTGTCTGCGTCATGTTCTTCTTCTGTCTTATGACGGAAAAGTGAGTTGGAGTCGTGTGGCGTTCAGGT and I need to count how many times they are co... |
|
Nov 30, 2017 at 7:58pm
[3 replies] Last: struct myCounter { unsigned int A; unsigned int G; unsigned int... (by AbstractionAnon)
|
|
by shbm111
2D array word search solver needs to work in 8 directions
|
| I need to make a word search program that takes in a txt file like this 15 N O L X Y H H J T R H H N F D R X Q M F R W F M R G A D P J X H B F V P A I A... |
|
Nov 30, 2017 at 6:27pm
[2 replies] Last: I am actually really lost... first can someone explain to me how the c... (by shbm111)
|
| AVI file too big to stuff into c array? |
| It seems like manipulating files is convoluted in any language. It's like... there's a sequence of bytes over there in a file, I want them as manipulable data i... |
|
Nov 30, 2017 at 6:17pm
[7 replies] Last: I tried JLBorges c example (taught me that fwrite automatically moves ... (by ineedastupidusername)
|
|
by XAHTC
Console Snake. Snake can crawl in opposite direction
|
| I have tried to make simple Snake from example and find one bug: snake can crawl in oppostie direction. I have tried to fix it by true-fals variables, but somet... |
|
Nov 30, 2017 at 5:50pm
[no replies]
|
|
by Yana111
Problems with functions
|
| I need to find x, y, sum and modulus of difference between y and sum using functions. But the program does not calculate the functions. Here is my code: #incl... |
|
Nov 30, 2017 at 5:46pm
[3 replies] Last: int result = findX(somevariable, 12, 5, anothervariable, ... etc.. );... (by jonnin)
|
|
by renticor
Cursor position, cout problem
|
| Hello, I have a problem with displaying text using cout << in a user-specified cursor position class kord { int posX, posY; std :: string text; p... |
|
Nov 30, 2017 at 5:34pm
[2 replies] Last: If you use Windows http://www.cplusplus.com/forum/beginner/4234/#CH_i1... (by Thomas1965)
|
|
by marqual123
Program Help Please!
|
| Program Not Functioning Properly! Please Help! My "Other isn't giving out the right output! Some of my other character are reading as special characters! I also... |
|
Nov 30, 2017 at 4:36pm
[3 replies] Last: Hello marqual123, After testing the program I found lie 50 to be a pr... (by Handy Andy)
|
|
by johson123
I cannot understand why my homework ask :(
|
| This is my second homework but is too hard to me, a lot of things i cannot understand. At Least help me finish two part, thanks a lots :D #include <iostream> ... |
|
Nov 30, 2017 at 3:51pm
[4 replies] Last: ok, got it (by johson123)
|
|
by adam2016
inheritance
|
| Hi guys I'm just wondering about inheritance and why this is and isn't legal first I don't understand how you can set a base class to be equalled to a derive... |
|
Nov 30, 2017 at 3:40pm
[7 replies] Last: You're welcome - glad it helped! (by MikeyBoy)
|
|
by ssmiller1
Hangman game
|
| I need help writing the .h file for this code. I'm new to c++ and have some scratch code written but it's honestly not even worth posting here. Main program pro... |
|
Nov 30, 2017 at 3:22pm
[1 reply] : Line 40: Your program has a hangman class, so you need to define that... (by AbstractionAnon)
|
| closest to the average |
| I wrote a program to get 10 numbers then find their average and then to cout the number that is closest to the average. for some reason when I entered ( 1.1 8.7... |
|
Nov 30, 2017 at 2:34pm
[1 reply] : what did I do wrong IMO, the first thing you did wrong was to use me... (by jlb)
|
| right angle triangle |
| I wrote this code to get a number from user and if it is possible to make a right angle triangle with it I want it to give out the numbers from smallest to bigg... |
|
Nov 30, 2017 at 1:12pm
[2 replies] Last: Breaking out from nested loops can be neater with a function: #includ... (by keskiverto)
|
|
by stonedviper
Can someone give me an opinion on this code?
|
| Hello! Yesterday when I was in a lecture of num. methods.My Professor said that programing is basically an automation of everyday tasks and time consuming exce... |
|
Nov 30, 2017 at 1:07pm
[4 replies] Last: All three answers are wrong (well, I suppose answer #2 is not wrong ,... (by helios)
|
|
by Shibitto
Sorry to bug you all but I need some advise
|
| I'm not sure if it's me but evertime I step away from c++ I keep forgetting, or worse going backwards but I'm still trying to stick at it, (even tho people say ... |
|
Nov 30, 2017 at 12:36pm
[4 replies] Last: You mean i'm doing this? Yes. We both do create three unrelated obj... (by keskiverto)
|
|
by kannu
please help me to fix this project showing lnk 2005 error on visual studio 2017
|
| #pragma once #include <iostream> #include<string> using namespace std; const int MAXPARKINGSPACE = 100; class carparked { private: string carMake... |
|
Nov 30, 2017 at 12:30pm
[2 replies] Last: Hello kannu, After figuring out that your code is in three sections I... (by Handy Andy)
|