DNA MATCHING, Suffix trees

[Startering]

Hey guys. I have a final project for school, and I've been assigned DNA Matching. It sounds really cool and the more I look into it, it gets cooler. But I have a problem... I don't understand the suffix trees and how to organize them... I've been on the internet searching and found some ok tutorials, but still not quite getting them. So right now in my code I have 2 random gens that print out 25 char long AGCT example: AGTCGTTAGCTATGGTAACATGCTA . So I have 2 (different) of those and want to know how to put them in a suffix tree or tries. Greatly appreciated any help that is given. Thanks!

P.S My code is very messy so I might clean it up and post it too.

[kevinkjt2000]

I am surprised that Rosetta Code did not have a C++ implementation.
http://rosettacode.org/wiki/Suffix_tree

So I googled, and found this one:
http://www.sanfoundry.com/cpp-program-implement-suffix-tree/

[keskiverto]

Perhaps: http://www.allisons.org/ll/AlgDS/Tree/Suffix/