C++

Forum

General C++ Programming - April 2011 (Page 9)

Can vectors be passed in function parameters?

Can and How do you pass a string vector from function to function?

[1 reply] : Same as every other type. However, you should pass it as a reference t... (by Athar)

Hi, I am trying to find the lowest score out of a group of 5 but for some reason it keeps telling me my lowestScore variable is undeclared even though I set to ...

[5 replies] Last: Hey computerdude: For a pretty easy fix, try declaring the 'lowestSc... (by Programmer3)

by Programmer3

My FINAL vector question?

Hey once again! My final question regarding vectors pertains to formatting an individual index. The vector in question contains 'char' values (one in each index...

[2 replies] Last: I want to take the character that is stored in a specific index and ma... (by Programmer3)

by Programmer3

One More Vector Issue?!?

Hey again! I got my last vector issue working. Now, I am successfully taking user input into vectors. However, my issue now is that after taking the input, I am...

[15 replies] Last: Thanks for your help. :) (by Programmer3)

by MAT8686

Inheritance not working

Hello community, I am trying to code a simple type game, just to keep myself busy and get better at classes and pointers. I was wondering if anyone could help ...

[7 replies] Last: Oh wow, I completely missed that, thanks. I got it working now. (by MAT8686)

by Programmer3

Assign Specific Input to Vectors?!?

Hi! I'm trying to write a specific program that compares the character values of two different user inputs of different lengths. Because these inputs can be of ...

[4 replies] Last: Thanks Diedrexier! I got it working now! (by Programmer3)

by majidkamali1370

Insert data in file

Hi. How can I insert data in a file, between other data? Can I use fstream or FILE for handling large-sized files? I use Borland C++. Tnx :)

[1 reply] : I am guessing you want to insert in the middle of two datasets in orde... (by diedrexler)

by sloumanaw

Concatenation unsigned characters

Hello, I need a small program in C + + that sends and receives frames from an Ethernet interface (using WinPcap or other). Please if anyone has a source code...

[3 replies] Last: wow... i'm not perfect programmer , but i think this is harder than... (by shbk)

by Beginner89

Counting letters in a sequence.

I was given an assignment to write a program that takes the string "ATGCTAGTATTTGGATAGATAGATAGATAGATAGATAGATAAAAAAATTTTTTTT " and count how many times "T...

[4 replies] Last: The crux of your problem is that when you find a match, you need to ad... (by Moschops)

by theisonews

what function do i use to compare a series of numbers

Hey. I want to create a program were the user enters 3 one digit number and the program compares that number in a container filled with a series of numbers. ...

[2 replies] Last: ok thanks, i have more question is this ok vector<int> twelve... (by theisonews)

by Stupebrett

C++0x

Hello everyone! The new C++ standard, called c++0x which will (probably) be released this year, will it drastically change the language? Like, will I need to ki...

[3 replies] Last: There are changes, but nothing code breaking. (by hanst99)

by hotdogs113

Class functions

Program wants you to create a class Stock, create string data fields for symbol and name of stock, double data fields for the closing and current prices, a co...

[3 replies] Last: I thought 2 constructors looked wrong.... (by hotdogs113)

by camouser

recursion

Write a recursive function writeLine() that writes a character repeatedly to form a line of n characters. For example, writeLine('*',5) should produce the line ...

[14 replies] Last: Yep, just coded it and compiled it. Works like a charm! (by TheNoobie)

by ecekid

Using The CImg Library With Visual C++ 2010 Express Edition

Hey everybody! Am new here, an new to C++ programming as well, so please bear with me I am doing an image processing project using Visual C++ 2010 Expres...

[1 reply] : 1. Always post relevant code. Most of the time it is impossible to k... (by webJose)

by sara90

parsing file problem

hello every one, i have a problem in parsing a text file this is a sample text file: 6 1 1 + 3 4 5 + * 3 4 5 * + 1 + 1 1 1 + 2 3 8 2 / - 1 + * the first...

[1 reply] : Not being harsh but you must try to implement what you think is a plau... (by diedrexler)

by behzadC

Quiz! Easy but Tricky for programmers, What you Think?

Hi Guys Today I had an Quiz and by accident my Lecture base 3 of the questions on the following concept:: int a ; int *p=a; and as you might know: ...

[7 replies] Last: The variable " a " is an array , but it degenerates into a pointer to... (by Duthomhas)

by kirenemook12

using the internet.

hello. i am trying to make a program that makes contact with other programs at other computers, something like a server. the only problem is, i don't know h...

[1 reply] : You're over your head on this one. If you want to get started network... (by Duthomhas)

by Gabyliz

can anybody help me

I have no clue on how to create an I-P-O program. an i have past the last 2 weeks trying to understand how to create one and i have 2 programs due by midnight i...

[17 replies] Last: It depends how many times you go round the loop, and how long each loo... (by Moschops)

by tejashs

XOR encryption of text files

guys i read this article on XOR encryption http://www.cplusplus.com/forum/articles/38516/ and tried to implement it for text files, but there are a few hurdle...

[3 replies] Last: i even used the ios::binary tag to open the files but its still the sa... (by tejashs)

by neomaniac

boost C++ libraries & Bootstrapping the Symbian build tools on ...

i'm working on Bootstrapping the Symbian build tools so i can build symbian ROM using kernel_taster_kit_for_see_2009 i read this article talking about how to d...

[no replies]

April 2011 Pages: 1... 7 8910 11... 37

Archived months: [mar2011] [may2011]

This is an archived page. To post a new message, go to the current page.