Beginners - C++ Forum - November 2014 (Page 23)

I need some help getting this to work please? #include <iostream> #include <fstream> #include <iomanip> using namespace std; int main () { ...

[5 replies] Last: bool same(true); for(int i=0;i< (whatever your array size is); i+... (by mutexe)

by salah

can anyone plz help me with this code as soon as possible, thanks

Write your question here. #include <iostream> #include <string> #include <ifstream> using namespace std; struct course { string code, titl...

[3 replies] Last: I'm clear on what you're doing. What is TA and why does it derive fro... (by kbw)

by new user

asking clearly big question in numbers are prime together

hi gentles, i tested a code that doesn't work. and i want you helping for the shortest code quickly. It's maddening me. The code's duty is showing numbers ...

[2 replies] Last: #include <iostream> int main() { // for each pair of numbers i a... (by JLBorges)

by iLiberate

issue with reference/RVDT function (1,2)

I don't have any syntax errors, but when I enter a number between 0 and 65536 I expect the function to return a value of 0 for error, but it keeps returning 1. ...

[23 replies] Last: No luck I guess =/ (by iLiberate)

by new user

big question in numbers are prime together...

hi gentles, i tested a code that doesn't work. and i want you helping for the shortest code quickly. It's maddening me. The code's duty is showing numbers ( le...

[6 replies] Last: my wrong and long code young programmers: #include <iostream> us... (by new user)

by vituaugusto94

Integer with 32 bits.

How can I create a integer with 32 bits? And how can I use scanf and printf with that? Thanks!

[6 replies] Last: Thanks! (by vituaugusto94)

by klanier

Array code

I am trying to run a program that will be able to calculate the average employment rate form the data that is read from the text. When the program executes, it ...

[1 reply] : The file employed_15-24yrsOld.txt is not where the program expects it.... (by coder777)

by kathay14

Arrays in Files

Can someone explain to me how one would go about using arrays to add or sort things from files. So I understand arrays, say this is to initialize and define it:...

[1 reply] : You can eighter assume a maximum capacity like 100 and no more or you ... (by coder777)

by Jon15

Reversing a string

I am having trouble reversing the string so that I can input the name in the middle of the reversed string. Where is my function wrong? #include<iostrea...

[1 reply] : Can you tell me what the values for i and j (i-j would be helpful for ... (by Zhuge)

by new user

big question in numbers are prime together

hi gentles, i have a code that doesn't work.and i want you helping for the shortest code quickly. It's maddening me. it shows numbers ( less than 20 ) are prime...

[1 reply] : There is no need to post the same question multiple times. http://www.... (by Zhuge)

by pukol

Ordered list using binary search

So, i created an ordered array of float. here is the code. //from main for(int i = 0; i < LIM; i++) { cout << ">> "; cin >> num; input(o...

[no replies]

by Seag

B-Tree Insertion Problem

Hello, I am building a B-Tree with data from a txt file, extracting a numerical record (as an int) and storing that in my B-Tree. I followed the debugger and ad...

[2 replies] Last: Well, this is too complex to skim through. You need to provide the tes... (by coder777)

by HG319

Bioinformatics program with string of DNA

This is just one part of the program. We have this file which contains a string of DNA (ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCC) ...

[4 replies] Last: Seag + substr ~> std::string temp; // fill temp from input // print ... (by keskiverto)

by Vandalism

Characters and String Functions

Desired output: https://app.box.com/s/r47o73hk1xix9gm0svdl Hi. I've been sitting here and searching everywhere how to solve this and i can't. Please help me. ...

[3 replies] Last: #include<iostream> #include<string> using namespace std; char phrase ... (by Vandalism)

by Vandalism

Error: Expression must have class type

Help! #include<iostream> #include<cstring> #include<algorithm> using namespace std; char phrase , ltr; int main() { cout << "Enter a strin...

[5 replies] Last: #include<iostream> #include<cstring> #include<algorithm> #include<str... (by Vandalism)

by JayhawkZombie

Inherit from std::runtime_error

Hello, everyone. I am having difficulty inheriting from std::runtime_error. All I have to do is construct an object with a message (I don't know why I can...

[1 reply] : #include <stdexcept> struct MazeCreationException : public virtual s... (by JLBorges)

by guardian115

Modular program utilizing array with at least 3 functions

I am completely lost with this assignment. I have been searching the internet and forums trying to piece together something that resembles a code but I am compl...

[no replies]

by kovyfan27

Function issues

Hi guys, I'm having problems with my code. I am trying to develop a code which gets the: weight, height, age, and gender from the user and in light of that info...

[5 replies] Last: #include<iostream> #include<string> //Function Headers using namespac... (by kovyfan27)

by tmmobley

Need to return element of an iterator.

Hello - I need this loop to return the element of the iterator, not the value. Can anyone point me in the right direction? int vectorsoo::check(int number) {...

[9 replies] Last: Yes, thanks. Corrected. (by JLBorges)

by ezmesori

Read records from file and store in dynamic array

So i have to define Student class, read the number of records in the input file, create a dynamic array of Students, read the records from the file and store th...

[1 reply] : Edit: So i fixed my dumb mistake on line 41 to cout << id << "\t" <... (by ezmesori)

C++

Forum

Beginners - November 2014 (Page 23)