please wait
| searching for int's in an array and keeping count |
| this is my assignment, and below is what i've done so far. Any help is appreciated. You are to write a program which will ask for the user to input 15 numbe... |
|
Feb 10, 2013 at 8:52pm
[4 replies] Last: cout<<"it should look like this:P"; (by supperpiccle)
|
|
by delmi
What's is wrong with my code? I cannot see the ouptut
|
| I have been told not to use the system("PAUSE"); But I still cannot see the output. What am I doing wrong? #include<iostream> #include<cmath> #include <limi... |
|
Feb 10, 2013 at 8:52pm
[no replies]
|
|
by chenzy
a question of reading file
|
| I am confusing about how to read a .txt file of infix expression . I want to read this file and,,,, For each infix expression, the program should print the orig... |
|
Feb 10, 2013 at 8:39pm
[no replies]
|
|
by Icshorts
ERROR CODE
|
| I am confused to what I'm doing wrong with this code. I keep getting this error message. 1>------ Build started: Project: LAB5A, Configuration: Debug Win32 ----... |
|
Feb 10, 2013 at 7:34pm
[3 replies] Last: void displayBelowAvg(...); void displayBelowAverage(...) { } You ... (by Branflakes91093)
|
|
by gdookie
Infinite Loop
|
| Read the "before you post" instructions and expect many rude answers. No problem..yes I'm a beginner and this is part of a homework assignment. Also your jobs a... |
|
Feb 10, 2013 at 7:13pm
[5 replies] Last: Thank you Cire! The explanation helped me immensely and I have a bette... (by gdookie)
|
|
by salsaaa
help with if statements and strings
|
| Hi! I'm relatively new to programming and I have been practicing some basic concepts. this is a short conversation I made. on line 18, I'm having trouble with t... |
|
Feb 10, 2013 at 7:02pm
[7 replies] Last: Here's my take on it (thought I'd use it as practice since I'm also ne... (by Fourc00h)
|
| arrays |
| Write a program which will get 10 random numbers onto one array1 of size 10. Get 10 more random numbers and place them in array2 of size 10. The range of the ... |
|
Feb 10, 2013 at 6:32pm
[1 reply] : Your best bet is to give it a go, see how far you get and post when yo... (by MrHutch)
|
|
by OMG Crackers
how to use my programming skills to make a game engine
|
| I know how to code its just using that knowledge to build something I learned how to code on my own sorta about 85% and I want to know where there is a good tut... |
|
Feb 10, 2013 at 5:37pm
[no replies]
|
|
by chazzerg
Cubic Equation Solver with output
|
| Hey guys. I need some help to make this program. It should work for every cubic equation (only one unknown) and solve it with desired method -bisection, secant ... |
|
Feb 10, 2013 at 5:16pm
[3 replies] Last: The problem is that I couldn't even approached it :D It's our just thi... (by chazzerg)
|
|
by syintel87
Extracting multiple lines into one string
|
| My input file loos like (20 lines in total) GCGAGTTCCCCCATGCGTGTCGGCCCCCGCGTCGCTTTTACTATATCCACCCCATTCCAT TGAAGGTATTTACTTGGGATCAAATACCGACTAGAGTTATTAAATCTTAATG... |
|
Feb 10, 2013 at 5:11pm
[6 replies] Last: kewl (by greenleaf800073)
|
|
by jeaninem71
Easy way to create large data files?
|
| I need a large data file for a program. Instead of typing every line by hand, is there a program that I can use to generate this text file a lot faster and eas... |
|
Feb 10, 2013 at 5:09pm
[12 replies] Last: kewl (by greenleaf800073)
|
|
by Phazon
Using typedef struct as a function parameter
|
| I have a couple of structs that I'm using, which work fine, but I want to pass one through as a parameter of a function and I'm not sure how to do it. typ... |
|
Feb 10, 2013 at 4:35pm
[5 replies] Last: See here: http://www.cplusplus.com/forum/beginner/89419/#msg480308 ... (by closed account zb0S216C)
|
|
by cppnoob99
Code Problem
|
| Well actually output problem. It compiles and links fine, but output is definitely not where it needs to be. Can someone with a "fresh set of eyes" see if you c... |
|
Feb 10, 2013 at 4:08pm
[4 replies] Last: @vin & cire ye that i was the issue can't believe I missed it, I don't... (by cppnoob99)
|
|
by mhel22
for loop
|
| hello guys, please help me in my exercise I don't how to this using for loop. this is the output: _________* ________** _______*** ______**** _____****... |
|
Feb 10, 2013 at 3:48pm
[2 replies] Last: You should try to make this output first to understand the "for" loop ... (by arzhon)
|
| Hangman |
| I've been working on a Hangman program lately and I've ran into a problem: every time the program runs, the word never randomizes, and there are always 5 unders... |
|
Feb 10, 2013 at 3:21pm
[2 replies] Last: Thanks! Its working perfectly now! (by closed account L1AkoG1T)
|
|
by jc4bs
First Occurrence of a Character in a C-String
|
| I am writing a code that takes a cstring from the user and outputs the number of words and the number of occurrences of each letter. It works, but at the end of... |
|
Feb 10, 2013 at 2:19pm
[2 replies] Last: Your code is invalid in the very beginning when you try to count words... (by vlad from moscow)
|
|
by mallony
Visual C++ 2010 Express, need help! Beginner C++ programmer
|
| Hi, I need someone to help me with Visual C++ 2010 Express programming. I'm new in C++. I want to make a program an i need a lot of help. |
|
Feb 10, 2013 at 12:59pm
[2 replies] Last: I want to make a auto ad poster. I want to know if it's ok to use Visu... (by mallony)
|
|
by noysoffer
Continued Fraction Calculator
|
| Hi, so I want to write a program that represents anything as a continued fraction (please see http://en.wikipedia.org/wiki/Continued_fraction). Here's my code ... |
|
Feb 10, 2013 at 11:32am
[2 replies] Last: The problem is that it's not returning accurate values. I think that I... (by noysoffer)
|
|
by ocdjg
Help with HW
|
| I am trying to compile this 7 file program but I've hit some road block. Here is the list of files I will be posting; BankAccountMain.cpp BankAccount.h Ban... |
|
Feb 10, 2013 at 10:22am
[19 replies] Last: OK just as a thread update. I finally was able to make the program com... (by ocdjg)
|
|
by isisoyyo
desctructor of a vector
|
| Dear Cplusplus' users, I create and use the following vector: std::vector< bool > component_select(1); component_select =true; And now I would like to... |
|
Feb 10, 2013 at 9:33am
[4 replies] Last: Dear JLBorges, thank-you for your answer and your recommendation. B... (by isisoyyo)
|