C++

Forum

Beginners - February 2013 (Page 48)

searching for int's in an array and keeping count

this is my assignment, and below is what i've done so far. Any help is appreciated. You are to write a program which will ask for the user to input 15 numbe...

[4 replies] Last: cout<<"it should look like this:P"; (by supperpiccle)

by delmi

What's is wrong with my code? I cannot see the ouptut

I have been told not to use the system("PAUSE"); But I still cannot see the output. What am I doing wrong? #include<iostream> #include<cmath> #include <limi...

[no replies]

by chenzy

a question of reading file

I am confusing about how to read a .txt file of infix expression . I want to read this file and,,,, For each infix expression, the program should print the orig...

[no replies]

by Icshorts

ERROR CODE

I am confused to what I'm doing wrong with this code. I keep getting this error message. 1>------ Build started: Project: LAB5A, Configuration: Debug Win32 ----...

[3 replies] Last: void displayBelowAvg(...); void displayBelowAverage(...) { } You ... (by Branflakes91093)

by gdookie

Infinite Loop

Read the "before you post" instructions and expect many rude answers. No problem..yes I'm a beginner and this is part of a homework assignment. Also your jobs a...

[5 replies] Last: Thank you Cire! The explanation helped me immensely and I have a bette... (by gdookie)

by salsaaa

help with if statements and strings

Hi! I'm relatively new to programming and I have been practicing some basic concepts. this is a short conversation I made. on line 18, I'm having trouble with t...

[7 replies] Last: Here's my take on it (thought I'd use it as practice since I'm also ne... (by Fourc00h)

by helpplease911

arrays

Write a program which will get 10 random numbers onto one array1 of size 10. Get 10 more random numbers and place them in array2 of size 10. The range of the ...

[1 reply] : Your best bet is to give it a go, see how far you get and post when yo... (by MrHutch)

by OMG Crackers

how to use my programming skills to make a game engine

I know how to code its just using that knowledge to build something I learned how to code on my own sorta about 85% and I want to know where there is a good tut...

[no replies]

by chazzerg

Cubic Equation Solver with output

Hey guys. I need some help to make this program. It should work for every cubic equation (only one unknown) and solve it with desired method -bisection, secant ...

[3 replies] Last: The problem is that I couldn't even approached it :D It's our just thi... (by chazzerg)

by syintel87

Extracting multiple lines into one string

My input file loos like (20 lines in total) GCGAGTTCCCCCATGCGTGTCGGCCCCCGCGTCGCTTTTACTATATCCACCCCATTCCAT TGAAGGTATTTACTTGGGATCAAATACCGACTAGAGTTATTAAATCTTAATG...

[6 replies] Last: kewl (by greenleaf800073)

by jeaninem71

Easy way to create large data files?

I need a large data file for a program. Instead of typing every line by hand, is there a program that I can use to generate this text file a lot faster and eas...

[12 replies] Last: kewl (by greenleaf800073)

by Phazon

Using typedef struct as a function parameter

I have a couple of structs that I'm using, which work fine, but I want to pass one through as a parameter of a function and I'm not sure how to do it. typ...

[5 replies] Last: See here: http://www.cplusplus.com/forum/beginner/89419/#msg480308 ... (by closed account zb0S216C)

by cppnoob99

Code Problem

Well actually output problem. It compiles and links fine, but output is definitely not where it needs to be. Can someone with a "fresh set of eyes" see if you c...

[4 replies] Last: @vin & cire ye that i was the issue can't believe I missed it, I don't... (by cppnoob99)

by mhel22

for loop

hello guys, please help me in my exercise I don't how to this using for loop. this is the output: _________* ________** _______*** ______**** _____****...

[2 replies] Last: You should try to make this output first to understand the "for" loop ... (by arzhon)

by closed account L1AkoG1T

Hangman

I've been working on a Hangman program lately and I've ran into a problem: every time the program runs, the word never randomizes, and there are always 5 unders...

[2 replies] Last: Thanks! Its working perfectly now! (by closed account L1AkoG1T)

by jc4bs

First Occurrence of a Character in a C-String

I am writing a code that takes a cstring from the user and outputs the number of words and the number of occurrences of each letter. It works, but at the end of...

[2 replies] Last: Your code is invalid in the very beginning when you try to count words... (by vlad from moscow)

by mallony

Visual C++ 2010 Express, need help! Beginner C++ programmer

Hi, I need someone to help me with Visual C++ 2010 Express programming. I'm new in C++. I want to make a program an i need a lot of help.

[2 replies] Last: I want to make a auto ad poster. I want to know if it's ok to use Visu... (by mallony)

by noysoffer

Continued Fraction Calculator

Hi, so I want to write a program that represents anything as a continued fraction (please see http://en.wikipedia.org/wiki/Continued_fraction). Here's my code ...

[2 replies] Last: The problem is that it's not returning accurate values. I think that I... (by noysoffer)

by ocdjg

Help with HW

I am trying to compile this 7 file program but I've hit some road block. Here is the list of files I will be posting; BankAccountMain.cpp BankAccount.h Ban...

[19 replies] Last: OK just as a thread update. I finally was able to make the program com... (by ocdjg)

by isisoyyo

desctructor of a vector

Dear Cplusplus' users, I create and use the following vector: std::vector< bool > component_select(1); component_select =true; And now I would like to...

[4 replies] Last: Dear JLBorges, thank-you for your answer and your recommendation. B... (by isisoyyo)

February 2013 Pages: 1... 46 474849 50... 67

Archived months: [jan2013] [mar2013]

This is an archived page. To post a new message, go to the current page.