How to count the number of times a letter appears in string.

[ukprakash]

Excuse me all. I am having a really hard time understanding how to tackle a homework problem I have.

The problem is:

"A DNA string is an ordered collection of the symbols ’A’, ’C’, ’G’, and
’T’. Given a DNA string s of length at most 1000 symbols, return four
integers (separated by spaces) counting the respective number of times that
the symbols ’A’, ’C’, ’G’, and ’T’ occur in s.

Sample Dataset:
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTG

Sample Output:
17 9 14 18"

I have a basic understanding of what the question wants, but I have no idea how to actually get started. Can someone give me an idea on what to do? I'm so utterly lost right now. Thank you.

[giblit]

Depending on how you get the DNA and store it there could be multiple ways.

Say we have a string with 100 characters like this

std::string DNA = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTG";

Then we want to loop through the string and add one to the letter count

int a = 0 , g = 0 , c = 0 , t = 0;

for( int i = 0; i < SIZE; ++i )
{
    //switch of if/else if
   //then increment the letter by one
}

//output the results 

[ukprakash]

Thank you so much for your help! It definitely put me in the right direction and I was able to complete it today.

Here's the final code:
------------------------------------------------------


#include <iostream>
#include <string>

using namespace std;

int main()
{
int a = 0 , g = 0 , c = 0, t = 0, i = 0, invalid = 0;
string s;
cout << "Please input your DNA sequence: " << endl;
getline(cin, s);
for (i = 0; i < s.length() && i < 1000; ++i)
{
//using switch construct
switch (tolower(s[i]))
{
case 'a':
a=a+1;
break;
case 'g':
g=g+1;
break;
case 'c':
c=c+1;
break;
case 't':
t=t+1;
break;
default:
invalid=invalid+1 ;
break;
}

}

if (invalid > 0)
{
cout<< "invalid input. It contains characters other than a, A, g, G, c, C, t, T"<< endl;
cout << " or a space" << endl;
}

else
{
cout << "the count of each nucleotides (Adenine: A, Guanine: G, Cytosine: C, and Thymine: T) in the input is: " << endl ;
cout << "Adenine (A) = " << a << endl ;
cout << "Cytosine (C) = " << c << endl ;
cout << "Guanine (G)= " << g << endl ;
cout << "Thymine (T) = " << t << endl ;
}

return (0);
}

[giblit]

another thing to mention. a = a + 1 is equivilant to a += 1; ( += is the compound of left hand side value + right hand value then assign to left hand ).

You can also use ++ operator which increments a value by 1.

a = a + 1;
//==
a += 1;
/==
++a; //or a++;